View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11928_high_120 (Length: 201)
Name: NF11928_high_120
Description: NF11928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11928_high_120 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 20 - 183
Target Start/End: Complemental strand, 49654595 - 49654432
Alignment:
| Q |
20 |
attcacttgccccacaacctgacctggacactggaattctgctccagtgtctgcaggtgcaccagtagatgctgaactcaacccattgcttccagttcca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
49654595 |
attcacttgccccacaacctgacctggacactggaattctgctccagtgtgtgcaggtgcaccggtagatgctgaactcaacccattgcttccagttcca |
49654496 |
T |
|
| Q |
120 |
ctctgagttttcttcatcttcttcttaccagaatctcctccgccactttgaccactcctgttct |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
49654495 |
ctctgagttttcttcatcttcttcttaccagaatctcctccgccactttgaccactcttgttct |
49654432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University