View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11928_high_13 (Length: 605)
Name: NF11928_high_13
Description: NF11928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11928_high_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 551; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 551; E-Value: 0
Query Start/End: Original strand, 14 - 588
Target Start/End: Complemental strand, 7594420 - 7593846
Alignment:
| Q |
14 |
gatgaagttcgtgaattttttgacccttttggtgattataataaagggattcgaagagctattggggtgcctgaatttcatgattttcttgtagcggaag |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7594420 |
gatgaagttcgtgaattttttgacccttttggtgattatactaaagggattcgaagagctattggggtgcctgaatttcatgattttcttgtagcggaag |
7594321 |
T |
 |
| Q |
114 |
caaattcagcggatgaaagaactaagaagaggcttcttgaagctgccattagtaggctcaagattaataattgcacgcttgcaaatagacaagttcagaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7594320 |
caaattcagcggatgaaagaactaagaagaggcttcttgaagctgccattagcaggctcaagattaataattgcacgcttgcaaatagacaagttcagaa |
7594221 |
T |
 |
| Q |
214 |
gattcgtcgattaaatggaatgtggaaaaggagtatgcatcgtctcgatgccactgaaacgcaccttaggagtggttcacacactagtaaggaagtgtgg |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7594220 |
gattcgtcgattaaatggaatgtggaaaaggagtatgcatcgtctcgatgccaccgaaacgcaccttaggagtggttcacacactagtaaggaagtgtgg |
7594121 |
T |
 |
| Q |
314 |
gaggatcatgtgctcgcaaaaagtcttgtgatactctacaactttctctatggtgaaacacacgcccgctctagaattttgtcgccaactaatgtaattg |
413 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7594120 |
gaggatcatgtgcttgcaaaaagtcttgtgatactctacaactttctctatggtgaaacacacgcccactctagaattttgtcgccaactaatgtaattg |
7594021 |
T |
 |
| Q |
414 |
ccaacttttctgcaccaccacagtcgctggcattgcctgctgttgcggcggcaatccgttagaggtggtgggacagggaatctacatacaaaggttgcac |
513 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7594020 |
ccaacttttctgcaccaccgcagtcgctggcattgcctgctgttgcggcggcaatccgttagaggtggtgggacagggaatctacatacaaaggttgcac |
7593921 |
T |
 |
| Q |
514 |
aattgacatgcttgacacaccatgcattctacattgtttttggtcttactttccttcttatttgggtatcttttt |
588 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7593920 |
aattgacatgcttgacacaccatgcattctacattgtttttggtcttactttccttcttatttgggtatcttttt |
7593846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University