View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11928_high_40 (Length: 407)
Name: NF11928_high_40
Description: NF11928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11928_high_40 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 16 - 399
Target Start/End: Original strand, 29640586 - 29640961
Alignment:
| Q |
16 |
caacatgtgtgccaaaaaagttgtttctattaaccttcagcaaaatgagatgctatgaatggatcatacccctttttgcattttagatct---aatcata |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
29640586 |
caacatgtgtgccaaaaaagttgtttctattaaccttcagcaaaatgagatgctatgaatggatcataccccgctttgcattttagatctttaaatcata |
29640685 |
T |
 |
| Q |
113 |
ataagttagaatttactgaaaaatagtaatctcacttcctatatgatgcaggtcttttaatttttaannnnnnnnnnnnatacaaacaaaccaaggaaat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
29640686 |
ataagttagaatttactgaaaaatagtaatctcacttcctat---atgcaggtcttttaattttt------ttttttttatacaaactaaccaaggaaat |
29640776 |
T |
 |
| Q |
213 |
ggattttccaagcatcttagtatcattgttctttgtcaaggcttctcttcacgttgttgtgnnnnnnnngttgttgttgaatatcccttgatgcgtcatc |
312 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||| ||||| |
|
|
| T |
29640777 |
ggattttctaagcatcttagtatcattgttctttgtcaaggcttctcttcacgttgttgtgtttttt---tttttgttgaatatcccttgatgcctcatc |
29640873 |
T |
 |
| Q |
313 |
atactgcaaataca-ttagtatctttatgatcatttggctcatgttggtgcccctgtttctaacaaacgtatggttcttcagctcatt |
399 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29640874 |
atactgcaaatacatttagtatctttatgatcatttgtctcatgttggtgcccctgtttctaacaaacgtatggttcttcagctcatt |
29640961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 302 - 399
Target Start/End: Original strand, 55155124 - 55155222
Alignment:
| Q |
302 |
gatgcgtcatcatactgcaaatacatta-gtatctttatgatcatttggctcatgttggtgcccctgtttctaacaaacgtatggttcttcagctcatt |
399 |
Q |
| |
|
||||| |||||||||||| || |||||| || ||||| |||||| ||| || |||||||||| |||||||| ||| |||||||||||||||| |||||| |
|
|
| T |
55155124 |
gatgcctcatcatactgccaacacattaagtctctttctgatcaattgtctaatgttggtgcacctgtttccaacgaacgtatggttcttcaactcatt |
55155222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University