View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11928_high_46 (Length: 391)
Name: NF11928_high_46
Description: NF11928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11928_high_46 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 342; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 342; E-Value: 0
Query Start/End: Original strand, 17 - 374
Target Start/End: Complemental strand, 7594203 - 7593846
Alignment:
| Q |
17 |
gaatgtggaaaaggagtatgcatcgtctcgatgccactgaaacgcaccttaggagtggttcacacactagtaaggaagtgtgggaggatcatgtgctcgc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
7594203 |
gaatgtggaaaaggagtatgcatcgtctcgatgccaccgaaacgcaccttaggagtggttcacacactagtaaggaagtgtgggaggatcatgtgcttgc |
7594104 |
T |
|
| Q |
117 |
aaaaagtcttgtgatactctacaactttctctatggtgaaacacacgcccgctctagaattttgtcgccaactaatgtaattgccaacttttctgcacca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7594103 |
aaaaagtcttgtgatactctacaactttctctatggtgaaacacacgcccactctagaattttgtcgccaactaatgtaattgccaacttttctgcacca |
7594004 |
T |
|
| Q |
217 |
ccacagtcgctggcattgcctgctgttgcggcggcaatccgttagaggtggtgggacagggaatctacatacaaaggttgcacaattgacatgcttgaca |
316 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7594003 |
ccgcagtcgctggcattgcctgctgttgcggcggcaatccgttagaggtggtgggacagggaatctacatacaaaggttgcacaattgacatgcttgaca |
7593904 |
T |
|
| Q |
317 |
caccatgcattctacattgtttttggtcttactttccttcttatttgggtatcttttt |
374 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7593903 |
caccatgcattctacattgtttttggtcttactttccttcttatttgggtatcttttt |
7593846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University