View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11928_high_79 (Length: 274)
Name: NF11928_high_79
Description: NF11928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11928_high_79 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 37 - 266
Target Start/End: Original strand, 41249279 - 41249509
Alignment:
| Q |
37 |
aaattagcttatcattttccacaaacagaattaagggcgtgtgcaaaatgcattgggccgtttcgtgatcaaaacattgttgcaccaaatgatgattcca |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41249279 |
aaattagcttatcattttccacaaacagaattaagggcgtgtgcaaaatgcattgggccgtttcgtgatcaaaacattgttgcaccaaatgatgattcca |
41249378 |
T |
|
| Q |
137 |
tacgtgactgaaacaccataatggttggttttacccaaaatggtggctccatctcagcagcca-atatcataagaaataggaatatccatacatgaacca |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41249379 |
tacgtgactgaaacaccataatggttggttttacccaaaatggtggctccatctcagcagccacatatcataagatataggaatatccatacatgaacca |
41249478 |
T |
|
| Q |
236 |
accaattttccaccgagctcctgtctgtgct |
266 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |
|
|
| T |
41249479 |
accaattttccaccgagctcctgtccgtgct |
41249509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University