View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11928_high_80 (Length: 273)
Name: NF11928_high_80
Description: NF11928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11928_high_80 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 1e-53; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 35 - 186
Target Start/End: Complemental strand, 54183830 - 54183679
Alignment:
| Q |
35 |
aggagatagacaaagataaacgaatactttaactattaaatttgcatgaatacaccaatattatctttatataaacatcaacgttcagacgggacgacat |
134 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
54183830 |
aggagatagacaaatatacacgaatactttaactattaaatttgcatgaatacaccaatattatctttatataaacatcaacgttcagacgggactacat |
54183731 |
T |
|
| Q |
135 |
ctttgtctttagannnnnnnattgcgctaatgcataaaaattatgaacgatg |
186 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
54183730 |
cttttcctttaggtttttttattgcgctaatgcataaaaattatgaacgatg |
54183679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University