View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11928_low_103 (Length: 240)
Name: NF11928_low_103
Description: NF11928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11928_low_103 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 11999304 - 11999082
Alignment:
| Q |
1 |
catgattaaatttaacaaacacttaaaatggtttcacattaaatttgagggcttgtttgcaacattttaataaatctttttaaaatgtcgcaaagacatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| |||| ||||||| ||||||||||| |
|
|
| T |
11999304 |
catgattaaatttaacaaacacttaaaatggtttcacattaaattggagggcttgtttgctacattttaataaatattttaaaaatgttgcaaagacatg |
11999205 |
T |
|
| Q |
101 |
tgtgagcattttgaaaagatatgtaagcatgactaactttgttatgtgacaaggactgactaacttggagaactttatgtaatgtcggggaccattttga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
11999204 |
tgtgagcattttgaaaagatatgtaagcatgactaactttgttaagtgacaaggactgactaacttggagaactttatgcaatgtcggggaccattttga |
11999105 |
T |
|
| Q |
201 |
aatggcttgattgatgcaagtgt |
223 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
11999104 |
gatggcttgattgatgcaagtgt |
11999082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University