View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11928_low_113 (Length: 228)
Name: NF11928_low_113
Description: NF11928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11928_low_113 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 17 - 212
Target Start/End: Original strand, 37713602 - 37713796
Alignment:
| Q |
17 |
aagaatccatccaaagcatactctggagacatatatccactacnnnnnnnttgttacatgtagcattttagcaagcatgtaaaaacatcttggcctggta |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
37713602 |
aagaatccatccaaagcatactctggagacatatatccactacaaaaaa-ttgttacatgtagcattttagcaagcatgtaaaaacatcttggcctagtg |
37713700 |
T |
 |
| Q |
117 |
aatatttgaataaataaacaaaacttgggaattgtgaattaaacttttaaaataacatttgcataaagaacttactaggttcccattactctttgg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
37713701 |
aatatttgaataaataaacaaaacttgggaattgtgaattaaacttttaaaataacatttgtataaagaacttactaggttcccattactctttgg |
37713796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 14 - 57
Target Start/End: Complemental strand, 36366713 - 36366670
Alignment:
| Q |
14 |
gagaagaatccatccaaagcatactctggagacatatatccact |
57 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
36366713 |
gagaagattccatccatagcatactctggagacatatagccact |
36366670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University