View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11928_low_118 (Length: 211)

Name: NF11928_low_118
Description: NF11928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11928_low_118
NF11928_low_118
[»] chr5 (1 HSPs)
chr5 (19-202)||(41224694-41224877)


Alignment Details
Target: chr5 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 19 - 202
Target Start/End: Original strand, 41224694 - 41224877
Alignment:
19 tctaaatcccttttttctgttagttaacatttaacaaagctttagcaactagaagaattcaagttgaagtttcctactttaatttcaaatttgatggctt 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
41224694 tctaaatcccttttttctgttagttaacatttaacaaagctttagcaactagaggaattcaagttgaagtttcctactttaatttcaaatttgatggctt 41224793  T
119 gtgttgtgctgcnnnnnnnaatcttcttcatttctttttatggttttcacacactgaaatttctgtctattttagatctctgct 202  Q
    ||||||||||||       ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||    
41224794 gtgttgtgctgctttttttaatcttcttcatttctttttatggtgttcacacactgaaatttctgtctattttagatctgtgct 41224877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University