View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11928_low_119 (Length: 209)
Name: NF11928_low_119
Description: NF11928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11928_low_119 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 16 - 187
Target Start/End: Complemental strand, 8135285 - 8135114
Alignment:
| Q |
16 |
agatgaactgcagaagattgtgaaatattcatcacgcggtacacgatactaacataccgacaatgtaatattaaaaatagaactaattgaatgtaacaac |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
8135285 |
agatgaactgcagaagattgtgaaatattcatcacgcggtacacgatactaacatgccgacactataatattaaaaatagaactaattgaatgtaacaac |
8135186 |
T |
|
| Q |
116 |
atgttttggtgtcatatcggatgctagacacgttttcaatctaaagtttcggagctacataggacacgtcga |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8135185 |
atgttttggtgtcatatcggatgctagacacgtcttcaatctaaagtttcggagctacataggacacgtcga |
8135114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University