View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11928_low_22 (Length: 528)
Name: NF11928_low_22
Description: NF11928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11928_low_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 468; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 468; E-Value: 0
Query Start/End: Original strand, 23 - 510
Target Start/End: Original strand, 56401763 - 56402250
Alignment:
| Q |
23 |
agttgattttattgaatttgggtcctctttacctgtgtttttgtgctctaagatcatactataaagtagaaccatcaagtattatatgatgtgaatgagt |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56401763 |
agttgattttattgaatttgggtcctctttacctgtgtttttgtgctctgagatcatactataaagtagaaccatcaagtattatatgatgtgaatgagt |
56401862 |
T |
|
| Q |
123 |
tgtattggccactggctagtatacctacaagaccgttgaatgtttcttttataattttcatccttttgatacttcttagttgcagctgaaaaatatgctt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56401863 |
tgtattggccactggctagtatacctacaagacccttgaatgtttcttttataattttcatcattttgatacttcttagttgcagctgaaaaatatgctt |
56401962 |
T |
|
| Q |
223 |
tgttcaaggggaaaagagaactttgatccttgtgtctttagataatgtttttatgcgttttagatgtaatttcatgttattgcacactgaacactgttaa |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
56401963 |
tgttcaaggggaaaagagaactttgatccttgtgtctttagataatgtttttatgcgttttagatgtaatttcatgttattgcacactgaactctgttaa |
56402062 |
T |
|
| Q |
323 |
gcttttatgcctcttgcctgcataatttgtatgataagctttctttggagaattcatattttgtagcgaatgcctcccaacacagaagtgagacttagat |
422 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56402063 |
gcttttatgcctcttgcctgcataatttgtatgataagctttatttggagaattcatattttgtagcgaatgcctcccaacacagaagtgagacttagat |
56402162 |
T |
|
| Q |
423 |
ccaaaggtattgattgtggaacaacttggccttttggtgtgattcacatttggcaaagggagctcaactcagaaaaagtggtcattga |
510 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56402163 |
ccaaaggtattgattgtggaacaacttggccttttggtgtgattcacatttggcaaagggagctcaactcagaaaaagtggtcattga |
56402250 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000008; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 164 - 249
Target Start/End: Complemental strand, 11319416 - 11319332
Alignment:
| Q |
164 |
gtttcttttataattttcatccttttgatacttcttagttgcagctgaaaaatatgctttgttcaaggggaaaagagaactttgat |
249 |
Q |
| |
|
||||||| |||| ||||| || ||||||| ||||||||||||||||||| |||||||||||| | ||||||| |||||| |||| |
|
|
| T |
11319416 |
gtttcttctatagttttcttcattttgatgtttcttagttgcagctgaaatgtatgctttgttc-atgggaaaatagaactctgat |
11319332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 164 - 249
Target Start/End: Complemental strand, 11477437 - 11477353
Alignment:
| Q |
164 |
gtttcttttataattttcatccttttgatacttcttagttgcagctgaaaaatatgctttgttcaaggggaaaagagaactttgat |
249 |
Q |
| |
|
||||||| |||| ||||| || ||||||| ||||||||||||||||||| |||||||||||| | ||||||| |||||| |||| |
|
|
| T |
11477437 |
gtttcttctatagttttcttcattttgatgtttcttagttgcagctgaaatgtatgctttgttc-atgggaaaatagaactctgat |
11477353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University