View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11928_low_43 (Length: 400)
Name: NF11928_low_43
Description: NF11928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11928_low_43 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 125; Significance: 3e-64; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 125; E-Value: 3e-64
Query Start/End: Original strand, 196 - 328
Target Start/End: Complemental strand, 52877291 - 52877159
Alignment:
| Q |
196 |
gtaagacttactgtaatcataacactcttctgaaatatcaccggggatatgaatacccaaaagatatcatatacaaatgcgcaacaaaggagtacagttg |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
52877291 |
gtaagacttactgtaatcataacactcttctggaatatcaccggggatatgaatacccaaaagatgtcatatacaaatgcgcaacaaaggagtacagttg |
52877192 |
T |
 |
| Q |
296 |
cgacctaagacatcaaatgcacatgaaaatgat |
328 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
52877191 |
cgacctaagacatcaaatgcacatgaaaatgat |
52877159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 14 - 61
Target Start/End: Complemental strand, 52877475 - 52877428
Alignment:
| Q |
14 |
agaaaatctagaaagaaacatgaaaatgtagatatttatagcaagatg |
61 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52877475 |
agaaaatctagaaagaaacatgaaaatgtagatatttatagcaagatg |
52877428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University