View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11928_low_71 (Length: 300)
Name: NF11928_low_71
Description: NF11928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11928_low_71 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 1 - 285
Target Start/End: Complemental strand, 44458850 - 44458566
Alignment:
| Q |
1 |
ttagtaacccaagtggcatcataagcatgctcaagcttagaagtctcacttgcattccatttctgcagttctttctaaagataggaaacacctaataaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44458850 |
ttagtaacccaagtggcatcataagcatgctcaagcttagaagtctcacttgcattccatttctgcagttctttctaaagataggaaacacctaataaac |
44458751 |
T |
 |
| Q |
101 |
aaatagggtgtcagagtgggaaacggttgaaatagtaccatgtagcatcctttaaatgaagaaataaaaactgttgatgagtatggaactaagatgtagc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
44458750 |
aaatagggtgtcagagtgggaaacggttgaaatagtaccatgtagcatcctttaaatgaagaaataaaaattgttgatgagtatggaactaagatgtagc |
44458651 |
T |
 |
| Q |
201 |
catagattgaacttttctttaaaaatggagatttattctttctctaatttcttgnnnnnnnnatttagagtaagaaacatttcat |
285 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44458650 |
cataaattgaacttttctttaaaaatggagatttattctttctctaatttcttgttttttttatttagagtaagaaacatttcat |
44458566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University