View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11928_low_73 (Length: 299)
Name: NF11928_low_73
Description: NF11928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11928_low_73 |
 | |
|
| [»] scaffold1319 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 16 - 194
Target Start/End: Complemental strand, 5331736 - 5331558
Alignment:
| Q |
16 |
attagcatatgcactcatatagttaacactaatctcatctcatctcatttagataaatcctactactccgatatattatataagaaaaaggtacatgtat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5331736 |
attagcatatgcactcatatagttaacactaatctcatctcatctcatttagataaatcctactactccgatatattatataagaaaaaggtacatgtat |
5331637 |
T |
|
| Q |
116 |
ttggcccaaatttagaccaatagatatgaattttttcttatatgaaaaatcggagggaatatcaatatgctttatatct |
194 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5331636 |
ttggcccaaatttagacgaatagatatgaattttttcttatatgaaaaatcggagggaatatcaatatgctttatatct |
5331558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1319 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold1319
Description:
Target: scaffold1319; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 93 - 131
Target Start/End: Complemental strand, 774 - 736
Alignment:
| Q |
93 |
atataagaaaaaggtacatgtatttggcccaaatttaga |
131 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
774 |
atataagagaaaggtacatgtatttggctcaaatttaga |
736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University