View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11928_low_84 (Length: 264)
Name: NF11928_low_84
Description: NF11928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11928_low_84 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 89; Significance: 6e-43; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 153 - 253
Target Start/End: Original strand, 10367240 - 10367340
Alignment:
| Q |
153 |
gtccatattcagtttctgtttttggattgtttggtgagttcaacagacatctcaaaattgcaattatcattttctttatttaggttggtattcttcttct |
252 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
10367240 |
gtccttattcagtttctgtttttggattgtttggtgagttcaacagacatctcaaaattgcaattatcatttgctttatgtaggttggtattcttcttct |
10367339 |
T |
|
| Q |
253 |
c |
253 |
Q |
| |
|
| |
|
|
| T |
10367340 |
c |
10367340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 16 - 85
Target Start/End: Original strand, 10367103 - 10367172
Alignment:
| Q |
16 |
aaacaaacaatagttacaaggaagtgtgctcaaaggaatgtgatccaaaatcagagagaaaaatatcgac |
85 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10367103 |
aaacaaacaatagttacaaggaagtgtgttcaaaggaatgtgatccaaaatcagagagaaaaatatcgac |
10367172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University