View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11928_low_86 (Length: 262)

Name: NF11928_low_86
Description: NF11928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11928_low_86
NF11928_low_86
[»] chr1 (1 HSPs)
chr1 (20-253)||(49693898-49694131)


Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 20 - 253
Target Start/End: Complemental strand, 49694131 - 49693898
Alignment:
20 gatggcgacgacacaaacagatccttgagtgagcttctccgcatcgaatctttctccttcttctctaacaccgatacgtgtccctgccttcgttgcggtc 119  Q
    |||||||| ||||||||||||||||| | |||||||||||||||||||||||| ||||||||||| |||||||| |||||||||||||||||||||||||    
49694131 gatggcgaggacacaaacagatccttcaatgagcttctccgcatcgaatctttatccttcttctccaacaccgacacgtgtccctgccttcgttgcggtc 49694032  T
120 gcgtcaggcttagcccaagtagagtacggagtgttgttttgggccttggaagctgaatcagcgggcttgttcttgggcttaacgttgggctcttttcaac 219  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
49694031 gcgtcaggcttagcccaagtagagtacggagtgttgttttgggccttggaagctgaatcagcgggcttgttcttgggcttaacgtagggctcttttcaac 49693932  T
220 accgcactgtgtcgcgaagagcttgaatctctgc 253  Q
    |||||| |||||||||||||||||||||||||||    
49693931 accgcattgtgtcgcgaagagcttgaatctctgc 49693898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University