View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11928_low_86 (Length: 262)
Name: NF11928_low_86
Description: NF11928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11928_low_86 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 20 - 253
Target Start/End: Complemental strand, 49694131 - 49693898
Alignment:
| Q |
20 |
gatggcgacgacacaaacagatccttgagtgagcttctccgcatcgaatctttctccttcttctctaacaccgatacgtgtccctgccttcgttgcggtc |
119 |
Q |
| |
|
|||||||| ||||||||||||||||| | |||||||||||||||||||||||| ||||||||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
49694131 |
gatggcgaggacacaaacagatccttcaatgagcttctccgcatcgaatctttatccttcttctccaacaccgacacgtgtccctgccttcgttgcggtc |
49694032 |
T |
 |
| Q |
120 |
gcgtcaggcttagcccaagtagagtacggagtgttgttttgggccttggaagctgaatcagcgggcttgttcttgggcttaacgttgggctcttttcaac |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
49694031 |
gcgtcaggcttagcccaagtagagtacggagtgttgttttgggccttggaagctgaatcagcgggcttgttcttgggcttaacgtagggctcttttcaac |
49693932 |
T |
 |
| Q |
220 |
accgcactgtgtcgcgaagagcttgaatctctgc |
253 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |
|
|
| T |
49693931 |
accgcattgtgtcgcgaagagcttgaatctctgc |
49693898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University