View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11928_low_94 (Length: 245)
Name: NF11928_low_94
Description: NF11928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11928_low_94 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 36375258 - 36375031
Alignment:
| Q |
1 |
tgacaagaacactagggtgtgaattccagcttttgatctttcgtagacaatcaaaatcatgcttgacaccattagaatttgaaactccaggtagaaccac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36375258 |
tgacaagaacactagggtgtgaattccagcttttgatcttttgtagacaatcaaaatcatgcttgacaccattagaatttgaaactccaggtagaaccac |
36375159 |
T |
 |
| Q |
101 |
tgattttggtgtcatcgaacgtctctgggttcgactgctgtggataagatacaccggcatgggaatattccatttttcgaactctttttgccatgtgtag |
200 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36375158 |
tgattttggtgtcatcgaatgtctctgggtttgactgctgtggataagatacaccggcatgggaatattccatttttcgaactctttttgccatgtgtag |
36375059 |
T |
 |
| Q |
201 |
agtgtggtctttggagctaggaccaatg |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
36375058 |
agtgtggtctttggagctaggaccaatg |
36375031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 128 - 223
Target Start/End: Original strand, 32250348 - 32250443
Alignment:
| Q |
128 |
ggttcgactgctgtggataagatacaccggcatgggaatattccatttttcgaactctttttgccatgtgtagagtgtggtctttggagctaggac |
223 |
Q |
| |
|
|||||||| || ||||||||||| ||||||| | ||| |||||||||| |||||||||| |||| |||||||||||||| |||||||||||||| |
|
|
| T |
32250348 |
ggttcgacggccatggataagataaaccggcacagaaatcttccattttttgaactcttttcgccacgtgtagagtgtggtttttggagctaggac |
32250443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 122 - 228
Target Start/End: Original strand, 8844870 - 8844976
Alignment:
| Q |
122 |
tctctgggttcgactgctgtggataagatacaccggcatgggaatattccatttttcgaactctttttgccatgtgtagagtgtggtctttggagctagg |
221 |
Q |
| |
|
|||||||||| ||| || |||||||||||||| |||| |||| |||||||||| ||||||||| ||||||||||||||||| ||||| || ||| |
|
|
| T |
8844870 |
tctctgggtttgacggccttggataagatacacgggcacaggaaccttccattttttgaactctttgcaccatgtgtagagtgtggattttggtgcaagg |
8844969 |
T |
 |
| Q |
222 |
accaatg |
228 |
Q |
| |
|
|| |||| |
|
|
| T |
8844970 |
actaatg |
8844976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University