View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11928_low_97 (Length: 243)
Name: NF11928_low_97
Description: NF11928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11928_low_97 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 20 - 243
Target Start/End: Complemental strand, 29672143 - 29671920
Alignment:
| Q |
20 |
gaccgtgggataattaaggagttgtgtaataaggagataaagagttcgatcttcactctcagcataatactgacaactaatagcaatactaacattggtc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29672143 |
gaccgtgggataattaaggagttgtgtaataaggagataaagagttcgatcttcactctcagcataatactgacaactaatagcaatactaacattggtc |
29672044 |
T |
|
| Q |
120 |
atttcnnnnnnnnnnnnnnnnnnttgggaaacctaaaagaataattatagcaactctgatctgcactctctagtgatttgcttttcgttactttgtttgc |
219 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29672043 |
atttcaaaaaaagaaagaaaaaattgggaaacctaaaagaataattatagcaactctgatctgcactctctagtgatttgcttttcgttactttgtttgc |
29671944 |
T |
|
| Q |
220 |
agaccatagaatacttacttttgc |
243 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
29671943 |
agaccatagaatacttacttttgc |
29671920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University