View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11929_high_25 (Length: 226)
Name: NF11929_high_25
Description: NF11929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11929_high_25 |
 |  |
|
| [»] scaffold0161 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 15 - 205
Target Start/End: Original strand, 32457090 - 32457280
Alignment:
| Q |
15 |
gagaagaacggagagggttttgtggtcaagtcggaagttgaggttattgagaatggcgccggacattggaacggagaaatgaagctcatacatggccgga |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
32457090 |
gagaagaacggagagggttttgtggtcaagtcggaagttgaggttattgagaatggcgccggacattggaacggagaaatgaagctcgtacatggccgga |
32457189 |
T |
 |
| Q |
115 |
gtgttgggggaaaggacggagacgacatcgcctttttggatgccgagggaagaaagtgatgaagcaagttgaagacatcttttgtgggttt |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32457190 |
gtgttgggggaaaggacggagacgacatcgcctttttggatgccgagggaagaaagtgatgaagcaagttgaagacatcttttgtgggttt |
32457280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 19 - 205
Target Start/End: Complemental strand, 32464041 - 32463855
Alignment:
| Q |
19 |
agaacggagagggttttgtggtcaagtcggaagttgaggttattgagaatggcgccggacattggaacggagaaatgaagctcatacatggccggagtgt |
118 |
Q |
| |
|
||||| |||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32464041 |
agaacagagaggcttttgtggtcgagtcggaagttgaggttattgagaatggcgccggacattggaacggagaaatgaagctcatacatggccggagtgt |
32463942 |
T |
 |
| Q |
119 |
tgggggaaaggacggagacgacatcgcctttttggatgccgagggaagaaagtgatgaagcaagttgaagacatcttttgtgggttt |
205 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32463941 |
tgggggaaaggacggagacgacgtcgcctttttggatgccgagggaagaaagtgatgaagcaagttgaagacatcttttgtgggttt |
32463855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0161 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: scaffold0161
Description:
Target: scaffold0161; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 23 - 205
Target Start/End: Complemental strand, 23461 - 23279
Alignment:
| Q |
23 |
cggagagggttttgtggtcaagtcggaagttgaggttattgagaatggcgccggacattggaacggagaaatgaagctcatacatggccggagtgttggg |
122 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||| |||||||||||||||||||||||||||||||| || ||||| |||||||||||||||||||| |
|
|
| T |
23461 |
cggagagggttttgtagtcaagtcggaagctgaggttgttgagaatggcgccggacattggaacggagaattgtagctcgtacatggccggagtgttggg |
23362 |
T |
 |
| Q |
123 |
ggaaaggacggagacgacatcgcctttttggatgccgagggaagaaagtgatgaagcaagttgaagacatcttttgtgggttt |
205 |
Q |
| |
|
|| |||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
23361 |
agagaggacggagacgacgtcgccttttacgatgccgagggaagaaagtgatgaagcaagttgaagacatcgtttatgggttt |
23279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University