View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11929_high_6 (Length: 404)
Name: NF11929_high_6
Description: NF11929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11929_high_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 129; Significance: 1e-66; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 234 - 378
Target Start/End: Original strand, 33435684 - 33435827
Alignment:
| Q |
234 |
tgtgtactcaataatatcgtgcataacgtattagttatgcacttctatctatcatatgaaataatcatcaatcagtaatttcgtttccaactcttgggtc |
333 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33435684 |
tgtgtactcaataatatcgtgcataacgtattagttatgcacttctatctatcatatgaaataatcatcaatcagtaatttcgtttccaactcttgggt- |
33435782 |
T |
 |
| Q |
334 |
agtaattattttctttgttagttttgtttgttatttacggtacat |
378 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
33435783 |
agtaattattttctctgttagttttatttgttatttacggtacat |
33435827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 19 - 171
Target Start/End: Original strand, 33435518 - 33435669
Alignment:
| Q |
19 |
gtgacactcactgcacaaccaaagagaacgcaattaggggcaggtgcagggatgactttcgttgttggtgtactaaaaactgttaaatcgactttctcca |
118 |
Q |
| |
|
|||| ||||||||||| ||||||||||| ||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
33435518 |
gtgatactcactgcactaccaaagagaatgcagttagcggcaggtgcagggatgactttcgttgttggtgtactaaaaactgttaaatggattttctcca |
33435617 |
T |
 |
| Q |
119 |
acaccaagatccatgaaatagactttataacataaactaaataaataaaatgc |
171 |
Q |
| |
|
|||||||||| ||||||||| ||||||||| || ||||||||||||||||||| |
|
|
| T |
33435618 |
acaccaagatgcatgaaatacactttataatat-aactaaataaataaaatgc |
33435669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 52 - 106
Target Start/End: Original strand, 33424780 - 33424834
Alignment:
| Q |
52 |
ttaggggcaggtgcagggatgactttcgttgttggtgtactaaaaactgttaaat |
106 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
33424780 |
ttagtggcaggtgcagggatgactttcgttgttggtgcactagaaactgttaaat |
33424834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University