View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11929_low_20 (Length: 283)
Name: NF11929_low_20
Description: NF11929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11929_low_20 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 94; Significance: 6e-46; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 150 - 247
Target Start/End: Complemental strand, 36541034 - 36540937
Alignment:
| Q |
150 |
cttattagttcaagctcttgtagttatcaatagatagtacatacccatacattcaatgaggcgctggaaactaataaatttctacctatcttgcttgc |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36541034 |
cttattagttcaagctcttgtagttatcaatagatagtacatacccatacattaaatgaggcgctggaaactaataaatttctacctatcttgcttgc |
36540937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 1 - 145
Target Start/End: Complemental strand, 36541560 - 36541412
Alignment:
| Q |
1 |
tgtgttgaatattgtttatttcttgttagttgacattgtttgtttcttnnnnnnnnnn----ttgtaacacccccatatgatattatttctctctaaggg |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
36541560 |
tgtgttgaatattgtttatttcttgttagttgacattgtttgtttcttaaaaaaaataaaaattgtaacacctctatatgatattatttctctctaaggg |
36541461 |
T |
|
| Q |
97 |
atgatttctattgtaacaacatgaatagcaacagatattttctatttct |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
36541460 |
atgatttctattgtaacaacatgaatagcaacaaatgttttctatttct |
36541412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University