View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11929_low_24 (Length: 249)

Name: NF11929_low_24
Description: NF11929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11929_low_24
NF11929_low_24
[»] chr2 (1 HSPs)
chr2 (1-237)||(4103931-4104167)


Alignment Details
Target: chr2 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 4104167 - 4103931
Alignment:
1 aatttagccaaaatacattaaacnnnnnnngagttggatcttttttatgaattcagggttcacaattctagatacatcctcataacgataaccaaaatta 100  Q
    |||||||||||||||||| ||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4104167 aatttagccaaaatacatgaaacaaaaaaagagttggatcttttttatgaattcagggttcacaattctagatacatcctcataacgataaccaaaatta 4104068  T
101 aaatttatgattgtatctttaaaagactcaagtatt-gttaatcatagcatattatgtttaattagtacggagaaatatccatttaaataagcaaatttt 199  Q
    || ||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||| |||||||||||||||||||||| ||||||||    
4104067 aa-tttatgattgtatctttaaaagactcaagtatttgttaatcataacatattatgtttaattagtatggagaaatatccatttaaataaacaaatttt 4103969  T
200 tctcttgcacagggaccacaatcatctaacttgactct 237  Q
    ||||||||||| |||||||||||||| |||||||||||    
4103968 tctcttgcacatggaccacaatcatccaacttgactct 4103931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University