View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11929_low_24 (Length: 249)
Name: NF11929_low_24
Description: NF11929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11929_low_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 4104167 - 4103931
Alignment:
| Q |
1 |
aatttagccaaaatacattaaacnnnnnnngagttggatcttttttatgaattcagggttcacaattctagatacatcctcataacgataaccaaaatta |
100 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4104167 |
aatttagccaaaatacatgaaacaaaaaaagagttggatcttttttatgaattcagggttcacaattctagatacatcctcataacgataaccaaaatta |
4104068 |
T |
 |
| Q |
101 |
aaatttatgattgtatctttaaaagactcaagtatt-gttaatcatagcatattatgtttaattagtacggagaaatatccatttaaataagcaaatttt |
199 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
4104067 |
aa-tttatgattgtatctttaaaagactcaagtatttgttaatcataacatattatgtttaattagtatggagaaatatccatttaaataaacaaatttt |
4103969 |
T |
 |
| Q |
200 |
tctcttgcacagggaccacaatcatctaacttgactct |
237 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
4103968 |
tctcttgcacatggaccacaatcatccaacttgactct |
4103931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University