View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11929_low_7 (Length: 389)
Name: NF11929_low_7
Description: NF11929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11929_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 76 - 372
Target Start/End: Original strand, 45327511 - 45327817
Alignment:
| Q |
76 |
ctgaggcggcgggtgaggagtgagtgttgttatattcattcaattcaattgac----------aacaaacaagtgaataatgaaatcaatggcgtcttct |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45327511 |
ctgaggcggcgggtgaggagtgagtgttgttatattcattcaattcaattgacacagagtgacaacaaacaagtgaataatgaaatcaatggcgtcttct |
45327610 |
T |
|
| Q |
166 |
caatcttcgaacaatttatgggtattgctgggtttgggtttagcaggaatttatgttttaaccagaaagcttaagcaaactgtgaaagaggatttgggtg |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45327611 |
caatcttcgaacaatttatgggtattgctgggtttgggtttagcaggaatttatgttttaaccagaaagcttaagcaaactgtgaaagaggatttgggtg |
45327710 |
T |
|
| Q |
266 |
ctttcattcaaaagcttcagttgcttcctcctccgcctcccgctcctcccaaagctcctcatccactcacttccctcactttcgccatctccgacttgta |
365 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45327711 |
ctttcattcaaaagcttcagttgcttcctcctccgcctcccgctcctcccaaagctcctcatccactcacttccctcactttcgccatctccgacttgta |
45327810 |
T |
|
| Q |
366 |
tgtcttt |
372 |
Q |
| |
|
||||||| |
|
|
| T |
45327811 |
tgtcttt |
45327817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University