View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11930_high_105 (Length: 271)
Name: NF11930_high_105
Description: NF11930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11930_high_105 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 1 - 260
Target Start/End: Original strand, 34120372 - 34120631
Alignment:
| Q |
1 |
taaaagttggttgttgcacattaaaatcataaatttccttccagtccctaacattttttgtatgctctgcttcaaaatatccaagcaagttaacttcatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34120372 |
taaaagttggttgttgcacattaaaatcataaatttccttccagtccctaacattttttgtatgctctgcttcaaaatatccaagcaagttaacttcatc |
34120471 |
T |
 |
| Q |
101 |
tcttctcaccttaatcttctcttccaaactaagttcaaaaaatttgtttgcagattcttcaattctctcacgtttatccaaaggcactttgtgattaata |
200 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34120472 |
tcttctcactttaaccttctcttccaaactaagttcaaaaaatttgtttgcagattcttcaattctctcacgtttatccaaaggcactttgtgattaata |
34120571 |
T |
 |
| Q |
201 |
acttgaaagaaaccccattctttacatgcttgaccaatttctttgaccaagtttttgatg |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34120572 |
acttgaaagaaaccccattctttacatgcttgaccaatttctttgaccaagttttcgatg |
34120631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University