View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11930_high_107 (Length: 271)
Name: NF11930_high_107
Description: NF11930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11930_high_107 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 15 - 260
Target Start/End: Original strand, 1530489 - 1530731
Alignment:
| Q |
15 |
agtaacaacagtgaaaacaaagaagagagacacaaacaccaacgttaatttcatatctcaattttggatcccgatcttgttcattatcaaagtttagatt |
114 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
1530489 |
agtaacaacggtgaaaacaaaga---gagacacaaacaccaacgttaatttcatatctcaattttggatcccgatcttattcattaccaaagtttagatt |
1530585 |
T |
|
| Q |
115 |
ttatcttcctttttcttcaacggtaatgcttgttctcacgagaaactttatgccgaaatcatcccgaccgctttggaagtttctttatgtaactgtagca |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| || |||||||||| |
|
|
| T |
1530586 |
ttatcttcctttttcttcaacggtaatgcttgttctcacgagaaactctatgccgaaatcatcccgaccgctttcgaagtttctttttgcaactgtagca |
1530685 |
T |
|
| Q |
215 |
ctctctctattttatatctaaccctccatgatttccatccattcat |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1530686 |
ctctctctattttatatctaaccctccatgatttccatccactcat |
1530731 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University