View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11930_high_113 (Length: 258)
Name: NF11930_high_113
Description: NF11930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11930_high_113 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 86 - 258
Target Start/End: Complemental strand, 40807707 - 40807535
Alignment:
| Q |
86 |
attattgtgcatgtg-tcttacttctattggatgaaaaattatgattctgcaattggcgaaaaatacacttggtagtgtgggtgaaaattttagccactg |
184 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| | |
|
|
| T |
40807707 |
attattgtgcatgtaatcttacttctattggatgaaaaattatgattctgcaattggcgaaaaatacacc-ggtagtgtgggtgaaaattttagccaccg |
40807609 |
T |
 |
| Q |
185 |
tcctttatcggatgacactccttcgtaacaatatcatcctttcccttcnnnnnnnagtttatgaatttatgtat |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
40807608 |
tcctttatcggatgacactccttcgtaacaatatcatcctttcccttctttttttagtttatgaatttatgtat |
40807535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 21 - 57
Target Start/End: Complemental strand, 40807745 - 40807709
Alignment:
| Q |
21 |
gagatatttgacctaaatatctatagatctttactac |
57 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
40807745 |
gagatatttggcctaaatatttatagatctttactac |
40807709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University