View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11930_high_113 (Length: 258)

Name: NF11930_high_113
Description: NF11930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11930_high_113
NF11930_high_113
[»] chr5 (2 HSPs)
chr5 (86-258)||(40807535-40807707)
chr5 (21-57)||(40807709-40807745)


Alignment Details
Target: chr5 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 86 - 258
Target Start/End: Complemental strand, 40807707 - 40807535
Alignment:
86 attattgtgcatgtg-tcttacttctattggatgaaaaattatgattctgcaattggcgaaaaatacacttggtagtgtgggtgaaaattttagccactg 184  Q
    ||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||| |    
40807707 attattgtgcatgtaatcttacttctattggatgaaaaattatgattctgcaattggcgaaaaatacacc-ggtagtgtgggtgaaaattttagccaccg 40807609  T
185 tcctttatcggatgacactccttcgtaacaatatcatcctttcccttcnnnnnnnagtttatgaatttatgtat 258  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||    
40807608 tcctttatcggatgacactccttcgtaacaatatcatcctttcccttctttttttagtttatgaatttatgtat 40807535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 21 - 57
Target Start/End: Complemental strand, 40807745 - 40807709
Alignment:
21 gagatatttgacctaaatatctatagatctttactac 57  Q
    |||||||||| ||||||||| ||||||||||||||||    
40807745 gagatatttggcctaaatatttatagatctttactac 40807709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University