View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11930_high_129 (Length: 242)
Name: NF11930_high_129
Description: NF11930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11930_high_129 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 1 - 103
Target Start/End: Original strand, 6278189 - 6278291
Alignment:
| Q |
1 |
gaatgtgtgggacatatcaattcctcccccacctgataacaaaattttaaatttatatgccactcatagatgaattttttaggctttgtttgagtatttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||| ||||||||||||| |||| |||||||||||| |
|
|
| T |
6278189 |
gaatgtgtgggacatatcaattcctcccccacgtgataacaaaattttaaatttatatatcactcatatatgaattttttagactttatttgagtatttg |
6278288 |
T |
 |
| Q |
101 |
aaa |
103 |
Q |
| |
|
||| |
|
|
| T |
6278289 |
aaa |
6278291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 137 - 242
Target Start/End: Original strand, 6278400 - 6278504
Alignment:
| Q |
137 |
attatttttgtagagaataataaattttattcccctaatcagaagaaatttttattatgnnnnnnnntgaattctctagaaccattctttctcaaagttc |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||| |||||||||| |||||||||||| ||||||||| |
|
|
| T |
6278400 |
attatttttgtagagaataataaattttatt-ccctaatcagacgaaatttttattatgaagaaaaatgaattctctggaaccattctttttcaaagttc |
6278498 |
T |
 |
| Q |
237 |
tcaatt |
242 |
Q |
| |
|
|||||| |
|
|
| T |
6278499 |
tcaatt |
6278504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University