View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11930_high_143 (Length: 211)
Name: NF11930_high_143
Description: NF11930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11930_high_143 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 15 - 193
Target Start/End: Original strand, 28845366 - 28845544
Alignment:
| Q |
15 |
cataggacagaccaattgttgtattgactcttcgttgcaacttgatgacatctctaggttagtagatgatgaatattccccacaagcataaatttttgcc |
114 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||| |||||||| |||| |||||||| ||||||||||||||||| |||| |||||| |
|
|
| T |
28845366 |
cataggacgtaccaattgttgtattgactcttcgttgcaacttgatggcatctctaagttaatagatgataaatattccccacaagcaaaaatatttgcc |
28845465 |
T |
|
| Q |
115 |
nnnnnnnaagcacccaacaaattatcattgcattgtattgtccactttggctcatctttcagcaatctccacacatgct |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
28845466 |
cttttttaagcacccaacaaattatcattgcattgtattgtccactttggctcatctttcagcaatctccagacatgct |
28845544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University