View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11930_high_147 (Length: 201)
Name: NF11930_high_147
Description: NF11930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11930_high_147 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 17 - 182
Target Start/End: Original strand, 40048621 - 40048786
Alignment:
| Q |
17 |
gaggagaacatgagtagaaagagtgagaaggaaaagataatttgattcatatttggcttgatgattgaagattgtggaggaacgtaaatgattggatttt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40048621 |
gaggagaacatgagtagaaagagtgagaaggaaaagataatttgattcatatttggcttgatgattgaagattgtggaggaatgtaaatgattggatttt |
40048720 |
T |
 |
| Q |
117 |
ttgttaatttgtatgttggatgtgttgattggagagtaatgagaggtggttttatatagagaccaa |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | || ||||||||| ||||||| ||| |||| |
|
|
| T |
40048721 |
ttgttaatttgtatgttggatgtgttgattggatggcaaggagaggtggatttatattgaggccaa |
40048786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University