View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11930_high_49 (Length: 420)
Name: NF11930_high_49
Description: NF11930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11930_high_49 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 31 - 348
Target Start/End: Complemental strand, 46093083 - 46092766
Alignment:
| Q |
31 |
tgtgtggcaaccacacgattgcgtgtggccaaaggaatccacttatcctctcaatgatgctcctgtcgtcatacaacagctacatatatcgactatatgg |
130 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46093083 |
tgtgtggcaaccacacgatagcgtgtggccaaaggaatccacttatcctctcaatgatgctcctgtcgtcatacaacagctacatatatcgactatatgg |
46092984 |
T |
|
| Q |
131 |
cccaactgtctgaattttgtttatactaattatatgctcctttcattgattcgtaaccagaacaagctacgcaacctcacataatcagttaattaacact |
230 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
46092983 |
cccaagtgtctgaattttgtttatactaattatatgctcctttcattgattcgtaaccagaacaagctacgcaacctcacataatcag-taattaacact |
46092885 |
T |
|
| Q |
231 |
atatacaaactctattcattgattcaaggaaatggtgataatggannnnnnnnnnnnnnnnngtgcgcaattat----ttacaaactctttgacattgtt |
326 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
46092884 |
atatacaaactctattcattgattgaaggaaattgtgataatgga---tactactactactagtgcgcaattatttaattacaaactctttgacattgtt |
46092788 |
T |
|
| Q |
327 |
tagtgttagaaaattccgacaa |
348 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
46092787 |
tagtgttagaaaattccgacaa |
46092766 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University