View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11930_high_56 (Length: 405)
Name: NF11930_high_56
Description: NF11930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11930_high_56 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 181 - 388
Target Start/End: Complemental strand, 24181310 - 24181103
Alignment:
| Q |
181 |
agatacagttaagaaaaggtggactgtttttcgcgctggctgttgccgtagcggtggtggaagtggtcgtggtgaggatatgctcttgtggttcacggcg |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
24181310 |
agatacagttaagaaaaggtggactgtttttcgcgctggctgttgccgtagcggtggtggaagtggtcgtggtgaggatatgctcttgtggctcacggcg |
24181211 |
T |
|
| Q |
281 |
gtggaaattccggtgacagccacaagcagcacatttgagggatctagggtcattgggattgagagatgatggtggcatgaattcaccacatccatcaagt |
380 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24181210 |
gtggaaattccggtgacagccacaagcagcacatttgagggatctagggtcattgggattgagagatgatggtggcatgaattcaccacatccatcaagt |
24181111 |
T |
|
| Q |
381 |
gcatgtcc |
388 |
Q |
| |
|
|||||||| |
|
|
| T |
24181110 |
gcatgtcc |
24181103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 1 - 117
Target Start/End: Complemental strand, 24181490 - 24181374
Alignment:
| Q |
1 |
gataagaaggtggtaaatgtgagagtggtggtggtgatgatgggcttgaaattggacttgggctatgacttgggcttgtactttgacttgggcttgtgct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24181490 |
gataagaaggtggtaaatgtgagagtggtggtggtgatgatgggcttgaaattggacttgggctatgacttgggcttgtactttgacttgggcttgtgct |
24181391 |
T |
|
| Q |
101 |
ttgactaattggaccac |
117 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
24181390 |
ttgactaattggaccac |
24181374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 262 - 316
Target Start/End: Original strand, 2494658 - 2494712
Alignment:
| Q |
262 |
gctcttgtggttcacggcggtggaaattccggtgacagccacaagcagcacattt |
316 |
Q |
| |
|
|||||| |||||||||||||||||| || ||||| |||||||||||||||||||| |
|
|
| T |
2494658 |
gctcttctggttcacggcggtggaagttacggtggcagccacaagcagcacattt |
2494712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 270 - 316
Target Start/End: Original strand, 3683929 - 3683975
Alignment:
| Q |
270 |
ggttcacggcggtggaaattccggtgacagccacaagcagcacattt |
316 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| || |||||||| |
|
|
| T |
3683929 |
ggttcacggcggtggaaattccggtgacaaccacatgcggcacattt |
3683975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 278 - 313
Target Start/End: Original strand, 46301092 - 46301127
Alignment:
| Q |
278 |
gcggtggaaattccggtgacagccacaagcagcaca |
313 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
46301092 |
gcggtggaagttccggtgacagccacaagcagcaca |
46301127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University