View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11930_high_60 (Length: 396)
Name: NF11930_high_60
Description: NF11930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11930_high_60 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 310; Significance: 1e-174; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 15 - 385
Target Start/End: Complemental strand, 6634625 - 6634256
Alignment:
| Q |
15 |
ttttctactttgttgttctattgcaatgtgtgttgctgcaattatgcttcaccaatgttcctttgcagtttcacaccctaataagatcacaaatttacct |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6634625 |
ttttctactttgttgttctattgcaatgtgtgttgctgcaattatacttcaccaatgttcctttgcagtttcacaccctaataagatcacaaatttacct |
6634526 |
T |
|
| Q |
115 |
ggtcaaccacatgttgattttcatcacttttcaggttatgtaaatgttgatgatcaaaacaaaaaagcactctttttctactttgttgaggctaagaatg |
214 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6634525 |
ggtcaaccacatgttgattttcatcagttttcaggttatgtaaatgttgatgatcaaaacaaaaaagcactctttttctactttgttgaggctaagaatg |
6634426 |
T |
|
| Q |
215 |
atgctgtttccaaaccacttgttctttggctcaatggaggtggttcttagt-ttttgtttcttttattagtaacattgattttcataactcatatagatn |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6634425 |
atgctgtttccaaaccacttgttctttggctcaatggaggtggttcttagttttttgtttcttttattagtaacattgattttcataactc--atagata |
6634328 |
T |
|
| Q |
314 |
nnnnnnnnttgaagttttgtgaaaaattgaactttggttcatgttgttttgaaggacctggttgttcatctc |
385 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
6634327 |
aaaaaaaattgaagttttgtgaaaaattgaactttgtttcatgttgttttgaaggacctggttgttcttctc |
6634256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University