View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11930_high_63 (Length: 384)
Name: NF11930_high_63
Description: NF11930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11930_high_63 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 2e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 13 - 285
Target Start/End: Complemental strand, 41366538 - 41366263
Alignment:
| Q |
13 |
atgcctcatccaatttctatatgggttgggaacnnnnnnnctcaattgtttgccagcttgcttttttacgactcaactcatgaaaacttatgagctaatg |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41366538 |
atgcctcatccaatttctatatgggttgggaacaaaaaaactcaattgtttttcagcttgcttttttacgactcaactcatgaaaacttatgagctaatg |
41366439 |
T |
|
| Q |
113 |
agttggtcggcaagcctgccccannnnnnnnna---acagctatagcttgagcagtttagctcttatgggatgtgattagagttccctattaattttttg |
209 |
Q |
| |
|
|||||| ||||||||||||||| ||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
41366438 |
agttggccggcaagcctgccccctttttttttttttacaactatagcttgagcagtttagctcttatgggatatgattagagttccctattaattttttg |
41366339 |
T |
|
| Q |
210 |
agtcgtgtccaacttcaattagtcatttgttaccggtattggatagaacaaaacaaaatataataacacaacataa |
285 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||| |||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
41366338 |
agtcatgtccaacttccattagtcatttgttactagtattggacagaacaatacaaaatataataacacaacataa |
41366263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University