View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11930_high_84 (Length: 321)
Name: NF11930_high_84
Description: NF11930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11930_high_84 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 1 - 306
Target Start/End: Complemental strand, 14516845 - 14516540
Alignment:
| Q |
1 |
tttctggtgtcaaatttgatcaaataagtggcagttattctgtgcagccggtccacctagcatgcagcaattccatcccatgcacagacgttgatttaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14516845 |
tttctggtgtcaaatttgatcaaataagtggcagttatactctgcagccggtccacctagcatgcagcaattccatcccatgcacagacgttgatttaac |
14516746 |
T |
|
| Q |
101 |
tgacattcagttaagaccttcccttagttataggggtatgcaacaagctatgtgttggaactcttatggaaaatcacaaggtcaattagtaccttcaagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14516745 |
tgacattcagttaagaccttcccttagttataggggaatgcaacaagctatgtgttggaactcttatggaaaatcacaaggtcaattagtaccttcaagt |
14516646 |
T |
|
| Q |
201 |
attgattattgtttgagaagtggtggtggattaattaagaggatagcaaagtcacatgatagtgtatgttataaaatgttatagatgttatctttggtta |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14516645 |
attgattattgtttgagaagtggtggtggattaattaagaggatagcaaagtcacatgatagtgtatgttataaaatgttatagatgttatctttagtta |
14516546 |
T |
|
| Q |
301 |
gttttg |
306 |
Q |
| |
|
|||||| |
|
|
| T |
14516545 |
gttttg |
14516540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University