View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11930_high_90 (Length: 300)
Name: NF11930_high_90
Description: NF11930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11930_high_90 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 259; Significance: 1e-144; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 14 - 284
Target Start/End: Complemental strand, 9933144 - 9932874
Alignment:
| Q |
14 |
tatctctcactagttatcatagaaagctttaaagggagaaataaatggcagattgggctccaattgttataggcttgatcttgtttgtgttattttcacc |
113 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9933144 |
tatctctcactagttatcatagaaagcttcaaagggagaaataaatggcagattgggctccaattgttataggcttgatcttgtttgtgttattttcacc |
9933045 |
T |
 |
| Q |
114 |
tggattactatttcagctacctggcaaaggcagggtggtggaatttgtcaatttccaaacaagtgccatttccatttttgttcattctcttctcttcttt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
9933044 |
tggattactatttcagctacctggcaaaggcagggtggtggaatttgttaatttccaaacaagtgccatttccatttttgttcattcccttctcttcttt |
9932945 |
T |
 |
| Q |
214 |
ggctttatggttatctttcttgttgccattaatgttcatatcaatagtggttaagtgatcatccacctatg |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9932944 |
ggctttatggttatctttcttgttgccattaatgttcatatcaatagtggttaagtgatcatccacctatg |
9932874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 23 - 273
Target Start/End: Complemental strand, 9938097 - 9937847
Alignment:
| Q |
23 |
ctagttatcatagaaagctttaaagggagaaataaatggcagattgggctccaattgttataggcttgatcttgtttgtgttattttcacctggattact |
122 |
Q |
| |
|
||||||| ||||||| ||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9938097 |
ctagttaacatagaacgctccaataggagaaataaatggcagattgggctccaattgttataggcttgatcttgtttgtgttattttcacctggattact |
9937998 |
T |
 |
| Q |
123 |
atttcagctacctggcaaaggcagggtggtggaatttgtcaatttccaaacaagtgccatttccatttttgttcattctcttctcttctttggctttatg |
222 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
9937997 |
atttcagctaccaggcaaaggcagggtggtggaatttgtcaatttccaaacaagtgctatttccatttttgttcattcccttctcttctttggatttatg |
9937898 |
T |
 |
| Q |
223 |
gttatctttcttgttgccattaatgttcatatcaatagtggttaagtgatc |
273 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||| | ||||||||||||||| |
|
|
| T |
9937897 |
gttatctttattgttgccattgatgttcatatctacagtggttaagtgatc |
9937847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University