View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11930_high_92 (Length: 297)
Name: NF11930_high_92
Description: NF11930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11930_high_92 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 1 - 283
Target Start/End: Original strand, 6000961 - 6001243
Alignment:
| Q |
1 |
gttatatattttttgggaccttacttctaaaaggtccaccaccaataactgcggtgctggtttaggaaaatgaggtacacaaagctccaaaattgtccac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6000961 |
gttatatattttttgggaccttacttctaaaaggtccaccaccaataactgcggtgctggtttaggaaaatgaggtacacaaagctccaaaattgtccac |
6001060 |
T |
 |
| Q |
101 |
taatacaagatgggattggcatggcgtattccactttacaatattggacttgtttaaaataattgctaggggccctatgaaatttaaaattaatgtaaaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6001061 |
taatacaagatgggattggcatggcgtattccactttacaatattggacttgtttaaaataattgctaggggccctatgaaatttaaaattaaagtaaaa |
6001160 |
T |
 |
| Q |
201 |
aatgccaaatgaaaaggtttaagnnnnnnnatgcaaagaaattagagtgatgaggcatcggatgatgaaatagacatgtaact |
283 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6001161 |
aatgccaaatgaaaatgtttaagtttttttatgcaaagaaattagagtgatgaggcatcggatgatgaaatagacatgtaact |
6001243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University