View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11930_low_100 (Length: 280)
Name: NF11930_low_100
Description: NF11930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11930_low_100 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 65 - 262
Target Start/End: Complemental strand, 3822432 - 3822235
Alignment:
| Q |
65 |
taatgaatcattacttaatgtcaatatagtaactccagtttcaatgatgatccttttggtctggatcattgctctcttgggctttctcaaagttgctgct |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3822432 |
taatgaatcattacttaatgtcaatatagtaactccagtttcaatgatgatccttttggtctggatcattgctctcttgggctttctcaaagttgctgct |
3822333 |
T |
|
| Q |
165 |
tcattgttgcgtcgcggtcaagagagacgtgatcgggcgggtcttattcctgaggatgaggtactaataaacttttatgagttttaacatcttagaat |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3822332 |
tcattgttgcgtcgcggtcaagagagacgtgatggggcgggtcttattcctgaggttgaggtactaataaacttttatgagttttaacatcttagaat |
3822235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 227 - 267
Target Start/End: Complemental strand, 4027433 - 4027393
Alignment:
| Q |
227 |
actaataaacttttatgagttttaacatcttagaattgcct |
267 |
Q |
| |
|
|||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
4027433 |
actaataagcttttatgagttttaacaacttagaattgcct |
4027393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 107 - 146
Target Start/End: Original strand, 27416605 - 27416644
Alignment:
| Q |
107 |
aatgatgatccttttggtctggatcattgctctcttgggc |
146 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
27416605 |
aatgatgatccttttgggctggatcattgctctcttgggc |
27416644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University