View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11930_low_116 (Length: 257)
Name: NF11930_low_116
Description: NF11930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11930_low_116 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 250
Target Start/End: Complemental strand, 27476266 - 27476016
Alignment:
| Q |
1 |
ctttcaaaactatatctaaatctttcataactaaatttagtaacaaaactatatataaaaaatttacnnnnnnnnctctcaaatttttcatnnnnnnnng |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| | |
|
|
| T |
27476266 |
ctttcaaaactatatctaaatctttcataactaaatttagtaacaaaactatatataaaaaatttacttttttttctctcaaatttttcataaaaaaaag |
27476167 |
T |
 |
| Q |
101 |
attaagagatatgtattttttgttaaa-tacctgtgttgagatcggatttggcagattttgcatagaaaaagctggtcagagaaaccaagatccccacac |
199 |
Q |
| |
|
|||||| |||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27476166 |
attaagggatatgtatttttttttaaaatacctgtgttgagatcggatttggcagattttgcatagaaaaagctggtcagagaaaccaagatccccacac |
27476067 |
T |
 |
| Q |
200 |
atgcaacactctgtctttggtagttgttctgcagagtttgttcctatgctt |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27476066 |
atgcaacactctgtctttggtagttgttctgcagagtttgttcctttgctt |
27476016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University