View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11930_low_121 (Length: 254)
Name: NF11930_low_121
Description: NF11930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11930_low_121 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 8 - 213
Target Start/End: Original strand, 962428 - 962629
Alignment:
| Q |
8 |
caaaaagattagacataataggaaaataaaatggttgttatccaaataatagtcaaaatataaagatttccaaaattcaaacaagaatctttatgagata |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
962428 |
caaaaagattagacataataggaaaataaaatggttgttatccaaataatagtcaaaatataaagatttccaaaattcaaacaagaatctttatgagata |
962527 |
T |
|
| Q |
108 |
ttgagcacattaattgccactagttttacagaagcttctctttctccaacctctataaaaaggaccaaaaccattaccccattgtgccatcacaaacaac |
207 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
962528 |
ttgagcac----attgccactagttttacataagcttctctttctccaacctctataaaaaggaccaaaaccattacaccattatgccatcacaaacaac |
962623 |
T |
|
| Q |
208 |
actttc |
213 |
Q |
| |
|
|||||| |
|
|
| T |
962624 |
actttc |
962629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University