View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11930_low_122 (Length: 252)
Name: NF11930_low_122
Description: NF11930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11930_low_122 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 95 - 180
Target Start/End: Complemental strand, 16841649 - 16841564
Alignment:
| Q |
95 |
tagatccaagtctttatgaaatttctgttagactcttatcaacctcgtcaaattttgttggatgttttgacaatatatgaataagc |
180 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
16841649 |
tagatccaagactttatgagatttctgttagactcttatcaacctcatcaaattatgttggatgttttgacaatatatgaataagc |
16841564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 13 - 55
Target Start/End: Complemental strand, 16841702 - 16841660
Alignment:
| Q |
13 |
agatgaatagatttatcgatatttttgaaagatccaagtcttt |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16841702 |
agatgaatagatttatcgatatttttgaaagatccaagtcttt |
16841660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University