View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11930_low_124 (Length: 250)
Name: NF11930_low_124
Description: NF11930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11930_low_124 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 5e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 14 - 231
Target Start/End: Original strand, 206522 - 206752
Alignment:
| Q |
14 |
tgagatgaatcaaacggcttctagggtttcacattgaccaaaccctgttctgttctgttctgt----------actttactttacttttgttgttcgaaa |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
206522 |
tgagatgaatcaaacggcttctagggtttcacattgaccaaaccctgttctgttctgttctgttctgtactttactttactttacttttgttgttcgaaa |
206621 |
T |
 |
| Q |
104 |
ctaaaacgaaccaaacacaaacacannnnnnnnnnnnnnnnn---tgtcgtcaaacacaaaaaccaataccctttcttcatcttcttcgtcttcttcact |
200 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
206622 |
ctaaaacgaaccaaacacaaacacaaagaagaagaagaagaagaatgtcgtcaaacacaaaaaccaataccctttcttcatcttcttcgtcttcttcact |
206721 |
T |
 |
| Q |
201 |
ctctcacgagcaaaagagcaatggtgtgttt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
206722 |
ctctcacgagcaaaagagcaatggtgtgttt |
206752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University