View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11930_low_127 (Length: 246)
Name: NF11930_low_127
Description: NF11930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11930_low_127 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 27476384 - 27476619
Alignment:
| Q |
1 |
acatacatctttgatatcattcataatataannnnnnn-gttatttagtgtggtctttggattattattattcaataatttctttcatgaaaattttgta |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27476384 |
acatacatctttgatatcattcataatataattttttttgttatttagtgtggtctttgaattattattattcaataatttctttcatgaaaattttgta |
27476483 |
T |
 |
| Q |
100 |
ggtattgtagtaacgtatatccaacaacagaattttttggaacatgtaattggtgtttgagtcagaacgaggattcaccaaattcttcaaattcttcatc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
27476484 |
ggtattgtagtaacgtatatccaacaacagaattttttggaacatgtaattggtgtttgagtcagaacgaggattcaccaaactcttcaaattcttcatc |
27476583 |
T |
 |
| Q |
200 |
ttcttacaagaaaaatgaaagcacagaagatgaagg |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
27476584 |
ttcttacaagaaaaatgaaagcacagaagatgaagg |
27476619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University