View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11930_low_138 (Length: 227)
Name: NF11930_low_138
Description: NF11930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11930_low_138 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 32567501 - 32567283
Alignment:
| Q |
1 |
taatgcactaaaagttacacaatatagcaagatccgataaacaaaggtagcatattcattgttgtgttgttgagttgtggttggttatccgtgtaaggaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32567501 |
taatgcactaaaagttacacaatatagcaagatccgataaacaaaggtagcatattcattgttgtgttgttgagttgtggttggttatccgtgtaaggaa |
32567402 |
T |
|
| Q |
101 |
gttttattcttggaatgtactgtatatccttgaatttcaatcggtatttttgttgtaaaagaaaatcattttcacttggtggt-ggtatccttcccttac |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
32567401 |
gttttattcttggaatgtactgtatatccttgaatttcaatcggtatttttgttgtaaaagaaaatcattttcacttggtggtgggtatccttcccttac |
32567302 |
T |
|
| Q |
200 |
cataaaattttgcctttgc |
218 |
Q |
| |
|
||||||||||||| ||||| |
|
|
| T |
32567301 |
cataaaattttgcttttgc |
32567283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 128 - 211
Target Start/End: Original strand, 28709892 - 28709974
Alignment:
| Q |
128 |
ccttgaatttcaatcggtatttttgttgtaaaagaaaatcattttcacttggtggtggtatccttcccttaccataaaattttg |
211 |
Q |
| |
|
|||||||| ||||||||||||| |||| |||| |||||||| ||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
28709892 |
ccttgaatctcaatcggtatttgtgttataaa-gaaaatcacattcacttggtggtggtatccttcccttactataatattttg |
28709974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University