View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11930_low_141 (Length: 223)
Name: NF11930_low_141
Description: NF11930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11930_low_141 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 11 - 206
Target Start/End: Original strand, 32853631 - 32853826
Alignment:
| Q |
11 |
agcaaaggccaaatgagttctgcagaatttgcatctatagaacctgccctccagctcaaccacaaagattcttcccattttctctcacttcaaaagggaa |
110 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32853631 |
agcaagggccaaatgagttctgcagaatttgcatctataggacctgccctccagctcaaccacaaagattcttcccattttctctcacttcaaaagggaa |
32853730 |
T |
|
| Q |
111 |
tggaagtttcagaattcagatattggatttgatgatgcgttggagaaaatgtactattagatagatagagaccagttggtgaaatgagacacgtgt |
206 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32853731 |
tggaagtttcagaattcagatattgaatttgatgatgcgttggagaaaatgtactattagatagatagagaccagttggtgaaatgagacacgtgt |
32853826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University