View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11930_low_141 (Length: 223)

Name: NF11930_low_141
Description: NF11930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11930_low_141
NF11930_low_141
[»] chr2 (1 HSPs)
chr2 (11-206)||(32853631-32853826)


Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 11 - 206
Target Start/End: Original strand, 32853631 - 32853826
Alignment:
11 agcaaaggccaaatgagttctgcagaatttgcatctatagaacctgccctccagctcaaccacaaagattcttcccattttctctcacttcaaaagggaa 110  Q
    ||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32853631 agcaagggccaaatgagttctgcagaatttgcatctataggacctgccctccagctcaaccacaaagattcttcccattttctctcacttcaaaagggaa 32853730  T
111 tggaagtttcagaattcagatattggatttgatgatgcgttggagaaaatgtactattagatagatagagaccagttggtgaaatgagacacgtgt 206  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32853731 tggaagtttcagaattcagatattgaatttgatgatgcgttggagaaaatgtactattagatagatagagaccagttggtgaaatgagacacgtgt 32853826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University