View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11930_low_150 (Length: 211)

Name: NF11930_low_150
Description: NF11930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11930_low_150
NF11930_low_150
[»] chr4 (1 HSPs)
chr4 (22-194)||(2263632-2263805)
[»] chr1 (1 HSPs)
chr1 (93-138)||(21324828-21324873)


Alignment Details
Target: chr4 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 22 - 194
Target Start/End: Complemental strand, 2263805 - 2263632
Alignment:
22 tatatgttttacgaattagcaatttcgttcgttgaacagtatattaagttcaattgttaaatactatgacatgacacgttaaatgaagatgtgacagttc 121  Q
    |||||||||||||||||||||||||||||||||||||| || |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||     
2263805 tatatgttttacgaattagcaatttcgttcgttgaacattacattaagttcaatcgttaaatactatgacatgacacgttaaatgaagatgtgacagttt 2263706  T
122 atattaattcaacatcattattagagatagaaacaggttaaatcatccgacaaaggcgtatcacc-agcctatt 194  Q
    ||||| ||||||||||| |||||||||||||||||| |||| || |||||||||| | ||||||| ||||||||    
2263705 atattgattcaacatcactattagagatagaaacagattaagtcgtccgacaaagacctatcacctagcctatt 2263632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 93 - 138
Target Start/End: Complemental strand, 21324873 - 21324828
Alignment:
93 tgacacgttaaatgaagatgtgacagttcatattaattcaacatca 138  Q
    ||||||||||||||||||||||| ||||||| | ||||| ||||||    
21324873 tgacacgttaaatgaagatgtgatagttcatgtgaattccacatca 21324828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University