View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11930_low_150 (Length: 211)
Name: NF11930_low_150
Description: NF11930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11930_low_150 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 22 - 194
Target Start/End: Complemental strand, 2263805 - 2263632
Alignment:
| Q |
22 |
tatatgttttacgaattagcaatttcgttcgttgaacagtatattaagttcaattgttaaatactatgacatgacacgttaaatgaagatgtgacagttc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || |||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2263805 |
tatatgttttacgaattagcaatttcgttcgttgaacattacattaagttcaatcgttaaatactatgacatgacacgttaaatgaagatgtgacagttt |
2263706 |
T |
 |
| Q |
122 |
atattaattcaacatcattattagagatagaaacaggttaaatcatccgacaaaggcgtatcacc-agcctatt |
194 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||| |||| || |||||||||| | ||||||| |||||||| |
|
|
| T |
2263705 |
atattgattcaacatcactattagagatagaaacagattaagtcgtccgacaaagacctatcacctagcctatt |
2263632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 93 - 138
Target Start/End: Complemental strand, 21324873 - 21324828
Alignment:
| Q |
93 |
tgacacgttaaatgaagatgtgacagttcatattaattcaacatca |
138 |
Q |
| |
|
||||||||||||||||||||||| ||||||| | ||||| |||||| |
|
|
| T |
21324873 |
tgacacgttaaatgaagatgtgatagttcatgtgaattccacatca |
21324828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University