View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11930_low_57 (Length: 405)

Name: NF11930_low_57
Description: NF11930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11930_low_57
NF11930_low_57
[»] chr8 (2 HSPs)
chr8 (181-388)||(24181103-24181310)
chr8 (1-117)||(24181374-24181490)
[»] chr7 (1 HSPs)
chr7 (262-316)||(2494658-2494712)
[»] chr6 (1 HSPs)
chr6 (270-316)||(3683929-3683975)
[»] chr3 (1 HSPs)
chr3 (278-313)||(46301092-46301127)


Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 181 - 388
Target Start/End: Complemental strand, 24181310 - 24181103
Alignment:
181 agatacagttaagaaaaggtggactgtttttcgcgctggctgttgccgtagcggtggtggaagtggtcgtggtgaggatatgctcttgtggttcacggcg 280  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
24181310 agatacagttaagaaaaggtggactgtttttcgcgctggctgttgccgtagcggtggtggaagtggtcgtggtgaggatatgctcttgtggctcacggcg 24181211  T
281 gtggaaattccggtgacagccacaagcagcacatttgagggatctagggtcattgggattgagagatgatggtggcatgaattcaccacatccatcaagt 380  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24181210 gtggaaattccggtgacagccacaagcagcacatttgagggatctagggtcattgggattgagagatgatggtggcatgaattcaccacatccatcaagt 24181111  T
381 gcatgtcc 388  Q
    ||||||||    
24181110 gcatgtcc 24181103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 1 - 117
Target Start/End: Complemental strand, 24181490 - 24181374
Alignment:
1 gataagaaggtggtaaatgtgagagtggtggtggtgatgatgggcttgaaattggacttgggctatgacttgggcttgtactttgacttgggcttgtgct 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24181490 gataagaaggtggtaaatgtgagagtggtggtggtgatgatgggcttgaaattggacttgggctatgacttgggcttgtactttgacttgggcttgtgct 24181391  T
101 ttgactaattggaccac 117  Q
    |||||||||||||||||    
24181390 ttgactaattggaccac 24181374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 262 - 316
Target Start/End: Original strand, 2494658 - 2494712
Alignment:
262 gctcttgtggttcacggcggtggaaattccggtgacagccacaagcagcacattt 316  Q
    |||||| |||||||||||||||||| || ||||| ||||||||||||||||||||    
2494658 gctcttctggttcacggcggtggaagttacggtggcagccacaagcagcacattt 2494712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 270 - 316
Target Start/End: Original strand, 3683929 - 3683975
Alignment:
270 ggttcacggcggtggaaattccggtgacagccacaagcagcacattt 316  Q
    ||||||||||||||||||||||||||||| ||||| || ||||||||    
3683929 ggttcacggcggtggaaattccggtgacaaccacatgcggcacattt 3683975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 278 - 313
Target Start/End: Original strand, 46301092 - 46301127
Alignment:
278 gcggtggaaattccggtgacagccacaagcagcaca 313  Q
    ||||||||| ||||||||||||||||||||||||||    
46301092 gcggtggaagttccggtgacagccacaagcagcaca 46301127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University