View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11930_low_65 (Length: 383)

Name: NF11930_low_65
Description: NF11930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11930_low_65
NF11930_low_65
[»] chr5 (2 HSPs)
chr5 (273-368)||(41620081-41620176)
chr5 (318-354)||(42121391-42121427)


Alignment Details
Target: chr5 (Bit Score: 96; Significance: 5e-47; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 273 - 368
Target Start/End: Original strand, 41620081 - 41620176
Alignment:
273 taatccatctttttaaaaggttataggaatgccactgacttatattgtttactatgaaagttcacaaatcaaactggttttactacttgtttttat 368  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41620081 taatccatctttttaaaaggttataggaatgccactgacttatattgtttactatgaaagttcacaaatcaaactggttttactacttgtttttat 41620176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 318 - 354
Target Start/End: Complemental strand, 42121427 - 42121391
Alignment:
318 tgtttactatgaaagttcacaaatcaaactggtttta 354  Q
    |||||||||||||||||||| |||||||||| |||||    
42121427 tgtttactatgaaagttcaccaatcaaactgatttta 42121391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University