View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11930_low_65 (Length: 383)
Name: NF11930_low_65
Description: NF11930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11930_low_65 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 96; Significance: 5e-47; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 273 - 368
Target Start/End: Original strand, 41620081 - 41620176
Alignment:
| Q |
273 |
taatccatctttttaaaaggttataggaatgccactgacttatattgtttactatgaaagttcacaaatcaaactggttttactacttgtttttat |
368 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41620081 |
taatccatctttttaaaaggttataggaatgccactgacttatattgtttactatgaaagttcacaaatcaaactggttttactacttgtttttat |
41620176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 318 - 354
Target Start/End: Complemental strand, 42121427 - 42121391
Alignment:
| Q |
318 |
tgtttactatgaaagttcacaaatcaaactggtttta |
354 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
42121427 |
tgtttactatgaaagttcaccaatcaaactgatttta |
42121391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University