View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11930_low_71 (Length: 375)
Name: NF11930_low_71
Description: NF11930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11930_low_71 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 16 - 356
Target Start/End: Complemental strand, 5053122 - 5052782
Alignment:
| Q |
16 |
tgaagaattgatggggctgtgaaatttattttgggctagttgttttaaaaatagactgatgaagttctctagtcccctcctttgatgaattggatcaaag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5053122 |
tgaagaattgatggggctgtgaaatttattttgggctagttgtttttaaaatcaactgatgaagttctctagtcccctcctttgatgaattggatcaaag |
5053023 |
T |
 |
| Q |
116 |
tcaataatgatggtgcattgaccaataaccctgttcaagcttcttctggggcatacttaaagactcaaaatggtatatgcaaaggtaga-ttaggcagaa |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
5053022 |
tcaataatgatggtgcattgaccaataaccctgttcaagcttcttctggggcatacttatagactc-aaatggtatatgcaaaggtagatttaggcagaa |
5052924 |
T |
 |
| Q |
215 |
tgttcaaactgattctcctttcactactaagattgttggtgcgctataatgataactacttcaaaaggctagcatagcttatggctagaagtgactctca |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5052923 |
tgttcaaactgattctcctttcactactaagatttttggtgcgctataatgataactacttcaaaaggctagcatagcttatggctagaagtgactctca |
5052824 |
T |
 |
| Q |
315 |
actagttttgttagcttttcaatcaaaatctttggttctttg |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5052823 |
actagttttgttagcttttcaatcaaaatctttggttctttg |
5052782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University