View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11930_low_88 (Length: 314)
Name: NF11930_low_88
Description: NF11930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11930_low_88 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 1 - 279
Target Start/End: Complemental strand, 48171191 - 48170913
Alignment:
| Q |
1 |
gagggaagtgttcattcacgatagcttgcaattgaacatgcattcatctatgcacgccgcactttgacacatctttgtatatttctgtcaaagtcttgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48171191 |
gagggaagtgttcattcacgatagcttgcaattgaacatgcattcatctatgcacgccgcactttgacacatctttgtatatttctgtcaaagtcttgtt |
48171092 |
T |
 |
| Q |
101 |
tatacatcaatcagtttggttgagcgagacaagtataacataaccgtatatatatcaaaatattataacttgaaactcgaccacccgcacatatatataa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48171091 |
tatacatcaatcagtttggttgagcgagacaagtataacataatcgtatatatatcaaaatattataacttgaaactcgaccacccgcacatatatataa |
48170992 |
T |
 |
| Q |
201 |
actttgttttgtttagtagagttcagctaaatgcatgtatttacctttagttcaagaacaagtgtgaagataaccgtga |
279 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48170991 |
actttgttttgttcagtagagttcagctaaattcatgtatttacctttagttcaagaacaagtgtgaagataaccgtga |
48170913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University