View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11930_low_96 (Length: 291)
Name: NF11930_low_96
Description: NF11930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11930_low_96 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 7e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 22 - 254
Target Start/End: Complemental strand, 1581592 - 1581358
Alignment:
| Q |
22 |
attgttcatatttttcctctacattaaacctaatgttgccttagctataaacaatttactgcatgccccagttacaaacaaaaacctcatcagtgttaac |
121 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| ||||| ||||||||||||||||||||||||||| ||| ||||||||||||||||||||| ||| |
|
|
| T |
1581592 |
attgttcatatttttcccctacattaaacctaatgtcgccttggctataaacaatttactgcatgccccaattataaacaaaaacctcatcagtgtcaac |
1581493 |
T |
 |
| Q |
122 |
agctttactaaaaataact--gtttcgatttcaatggttactaagtaatatgcatatatagttctctcgttactttgtatttgaggctgcacattacaaa |
219 |
Q |
| |
|
| ||||||||||||||||| ||||||||||||||| | ||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
1581492 |
aactttactaaaaataactttgtttcgatttcaatgttgactaagtaatatgcatatatagttctcacgttactttgtatttgaggctacacattacaaa |
1581393 |
T |
 |
| Q |
220 |
atcataatatgcttgagcatgataaaatgtgaagc |
254 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| |
|
|
| T |
1581392 |
atcataatatgcttgagcatgataaaatatgaagc |
1581358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University